![]()
A TXT-type anvi’o artifact. This artifact is typically generated, used, and/or exported by anvi’o (and not provided by the user)..
🔙 To the main page of anvi’o programs and artifacts.
There are no anvi’o tools that require this artifact directly, which means it is most likely an end-product for the user.
This is the output of anvi-report-inversions.
anvi-report-inversions searches for inversions in every single sample at a time and thus generates a TAB-delimited table for every sample: INVERSIONS-IN-SAMPLE_01.txt, INVERSIONS-IN-SAMPLE_02, …
Here is an example output:
| entry_id | sample_name | contig_name | first_seq | midline | second_seq | first_start | first_end | first_oligo_primer | first_oligo_reference | second_start | second_end | second_oligo_primer | second_oligo_reference | num_mismatches | num_gaps | length | distance |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| c_000000000001_10214_10541 | S01 | c_000000000001 | TGTTTCAAAAAACGTTCGT | ||||||||||x|||||||| | ACGAACGTCTTTTGAAACA | 10306 | 10325 | TCGATCAATTGATGTTTCAAAA.ACGTTCGT | CTTTTG | 10493 | 10512 | TCAGTAGTGAATGTGTTTCAAAA.ACGTTCGT | TTAATA | 1 | 0 | 19 | 168 |
| c_000000000002_10148_11135 | S01 | c_000000000002 | TGTTTCAAAAAACGTTCGT | ||||||||||||||||||| | ACGAACGTTTTTTGAAACA | 10514 | 10533 | AGATACGGTTTATGTTTCAAAAAACGTTCGT | CTTTTG | 10724 | 10743 | AGAAAAGAAGGCGTGTTTCAAAAAACGTTCGT | TCAATG | 0 | 0 | 19 | 191 |
These tables contains the following columns:
Anvi’o eventually create a consensus table with all the unique inversions found across all your samples in a file called INVERSIONS-CONSENSUS.txt. This table has the same format as the individual sample outputs, with the ‘entry ID’ replaced by a unique inversion ID. It also has column reporting the samples where the inversion was detected.
The table should look like this:
| inversion_id | contig_name | first_seq | midline | second_seq | first_start | first_end | second_start | second_end | num_mismatches | num_gaps | length | distance | num_samples | sample_names | first_oligo_primer | first_oligo_reference | second_oligo_primer | second_oligo_reference |
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| INV_0001 | c_000000000001 | TGTTTCAAAAAACGTTCGT | ||||||||||x|||||||| | ACGAACGTCTTTTGAAACA | 10306 | 10325 | 10493 | 10512 | 1 | 0 | 19 | 168 | 3 | S01,S02,S03 | TCGATCAATTGATGTTTCAAAA.ACGTTCGT | CTTTTG | TCAGTAGTGAATGTGTTTCAAAA.ACGTTCGT | TTAATA |
| INV_0002 | c_000000000002 | TGTTTCAAAAAACGTTCGT | ||||||||||||||||||| | ACGAACGTTTTTTGAAACA | 10514 | 10533 | 10724 | 10743 | 0 | 0 | 19 | 191 | 3 | S01,S02,S03 | AGATACGGTTTATGTTTCAAAAAACGTTCGT | CTTTTG | AGAAAAGAAGGCGTGTTTCAAAAAACGTTCGT | TCAATG |
Another default output table is named ALL-STRETCHES-CONSIDERED.txt and it reports every stretch that passed the ‘Identifying regions of interest’ parameters. It reports the maximum coverage of FWD/FWD and REV/REV in that stretch, per sample. It also reports the number of palindromes found and if a true inversion was confirmed.
| entry_id | sequence_name | sample_name | contig_name | start_stop | max_coverage | num_palindromes_found | true_inversions_found |
|---|---|---|---|---|---|---|---|
| S01_c_000000000001_10214_10541 | c_000000000001_10214_10541 | S01 | c_000000000001 | 10214-10541 | 16 | 4 | False |
| S01_c_000000000002_10148_11135 | c_000000000002_10148_11135 | S01 | c_000000000002 | 10148-11135 | 69 | 20 | False |
| S02_c_000000000001_10283_10542 | c_000000000001_10283_10542 | S02 | c_000000000001 | 10283-10542 | 11 | 3 | False |
| S02_c_000000000002_10200_11052 | c_000000000002_10200_11052 | S02 | c_000000000002 | 10200-11052 | 96 | 17 | False |
| S03_c_000000000001_10033_10801 | c_000000000001_10033_10801 | S03 | c_000000000001 | 10033-10801 | 30 | 12 | False |
| S03_c_000000000002_10498_10764 | c_000000000002_10498_10764 | S03 | c_000000000002 | 10498-10764 | 13 | 2 | False |
If the user enable the reporting of the genomic context, two addition TAB-delimited tables are generated: INVERSIONS-CONSENSUS-SURROUNDING-GENES.txt and INVERSIONS-CONSENSUS-SURROUNDING-FUNCTIONS.txt.
The first table report the gene calls surrounding every inversion when possible:
| inversion_id | entry_type | gene_callers_id | start | stop | direction | partial | call_type | source | version | contig |
|---|---|---|---|---|---|---|---|---|---|---|
| INV_0001 | FIRST_PALINDROME | Â | 10306 | 10325 | Â | Â | Â | Â | Â | c_000000000001 |
| INV_0001 | SECOND_PALINDROME | Â | 10493 | 10512 | Â | Â | Â | Â | Â | c_000000000001 |
| INV_0001 | GENE | 6 | 6818 | 7595 | r | 0 | 1 | prodigal | v2.6.3 | c_000000000001 |
| INV_0001 | GENE | 7 | 7632 | 8976 | r | 0 | 1 | prodigal | v2.6.3 | c_000000000001 |
| INV_0001 | GENE | 8 | 9145 | 9616 | r | 0 | 1 | prodigal | v2.6.3 | c_000000000001 |
| INV_0001 | GENE | 9 | 9651 | 10170 | r | 0 | 1 | prodigal | v2.6.3 | c_000000000001 |
| INV_0001 | GENE | 10 | 11311 | 14161 | r | 0 | 1 | prodigal | v2.6.3 | c_000000000001 |
| INV_0001 | GENE | 11 | 14165 | 14495 | r | 0 | 1 | prodigal | v2.6.3 | c_000000000001 |
| INV_0001 | GENE | 12 | 14524 | 16072 | r | 0 | 1 | prodigal | v2.6.3 | c_000000000001 |
The second table report the function associated to every gene call reported in the first file:
| inversion_id | gene_callers_id | source | accession | function |
|---|---|---|---|---|
| INV_0001 | 6 | COG20_FUNCTION | COG1208 | NDP-sugar pyrophosphorylase, includes eIF-2Bgamma, eIF-2Bepsilon, and LPS biosynthesis protein s (GCD1) (PDB:6JQ8) |
| INV_0001 | 6 | COG20_CATEGORY | J | Translation, ribosomal structure and biogenesis |
| INV_0001 | 6 | KOfam | K00978 | glucose-1-phosphate cytidylyltransferase [EC:2.7.7.33] |
| INV_0001 | 7 | COG20_FUNCTION | COG0399 | dTDP-4-amino-4,6-dideoxygalactose transaminase (WecE) (PDB:4PIW) (PUBMED:15271350) |
| INV_0001 | 7 | COG20_CATEGORY | M | Cell wall/membrane/envelope biogenesis |
| INV_0001 | 7 | KOfam | K12452 | CDP-4-dehydro-6-deoxyglucose reductase, E1 [EC:1.17.1.1] |
| INV_0001 | 9 | COG20_FUNCTION | COG0250 | Transcription termination/antitermination protein NusG (NusG) (PDB:3EWG) (PUBMED:19500594) |
| INV_0001 | 9 | COG20_CATEGORY | K | Transcription |
| INV_0001 | 10 | COG20_FUNCTION | COG2605 | Predicted kinase related to galactokinase and mevalonate kinase (PDB:4USK) |
| INV_0001 | 10 | COG20_CATEGORY | R | General function prediction only |
| INV_0001 | 10 | KOfam | K05305 | fucokinase [EC:2.7.1.52] |
| INV_0001 | 11 | COG20_FUNCTION | COG3254 | L-rhamnose mutarotase (RhaM) (PDB:1X8D) |
| INV_0001 | 11 | COG20_CATEGORY | M | Cell wall/membrane/envelope biogenesis |
| INV_0001 | 11 | KOfam | K03534 | L-rhamnose mutarotase [EC:5.1.3.32] |
| INV_0001 | 12 | COG20_FUNCTION | COG0305 | Replicative DNA helicase (DnaB) (PDB:1B79) |
| INV_0001 | 12 | COG20_CATEGORY | L | Replication, recombination and repair |
| INV_0001 | 12 | KOfam | K02314 | replicative DNA helicase [EC:3.6.4.12] |
Finally, if the user provide R1 and R2 fastq files and enable the reporting of inversion’s activity, anvi-report-inversions will generate a long-format file named INVERSION-ACTIVITY.txt. This file reports, for every inversion and sample, the relative proportion and read abundance of unique oligos, which either correspond to the reference contig (no inversion), or to an inversion sequence. The inversion’s activity is computed and reported for both side of each inversion.
| sample | inversion_id | oligo_primer | oligo | reference | frequency_count | relative_abundance |
|---|---|---|---|---|---|---|
| S01 | INV_0001 | first_oligo_primer | TTAATA | False | 6 | 0.097 |
| S01 | INV_0001 | first_oligo_primer | CTTTTG | True | 55 | 0.887 |
| S01 | INV_0001 | first_oligo_primer | CTTTTT | False | 1 | 0.016 |
| S01 | INV_0001 | second_oligo_primer | CTTTTG | False | 11 | 0.169 |
| S01 | INV_0001 | second_oligo_primer | TTAATA | True | 54 | 0.831 |
| S01 | INV_0002 | first_oligo_primer | TCAATG | False | 37 | 0.587 |
| S01 | INV_0002 | first_oligo_primer | CTTTTG | True | 25 | 0.397 |
| S01 | INV_0002 | first_oligo_primer | TCAATT | False | 1 | 0.016 |
| S01 | INV_0002 | second_oligo_primer | CTTTTG | False | 53 | 0.609 |
| S01 | INV_0002 | second_oligo_primer | TCAATG | True | 33 | 0.379 |
| S01 | INV_0002 | second_oligo_primer | TCAATC | False | 1 | 0.011 |
Edit this file to update this information.